ID: 1203738756_1203738775

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1203738756 1203738775
Species Human (GRCh38) Human (GRCh38)
Location Un_GL000216v2:161185-161207 Un_GL000216v2:161236-161258
Sequence CCCTCCCAACACCTTCGGACGGC GACGACGAAAGAGACTTGTTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!