ID: 1203791688_1203791700

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1203791688 1203791700
Species Human (GRCh38) Human (GRCh38)
Location EBV:155022-155044 EBV:155069-155091
Sequence CCTTGCCCGCATCATGGGGTCGC CTAATTTTGCCCAGAGAGGCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!