ID: 900023707_900023719

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 900023707 900023719
Species Human (GRCh38) Human (GRCh38)
Location 1:202596-202618 1:202632-202654
Sequence CCTGCCTTTGCTGGCCAGCTGGG GGAAATTAAGGCTGCAGGGTTGG
Strand - +
Off-target summary No data {0: 4, 1: 3, 2: 3, 3: 22, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!