ID: 900094913_900094925

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 900094913 900094925
Species Human (GRCh38) Human (GRCh38)
Location 1:936387-936409 1:936402-936424
Sequence CCCCGGTCCCGCCTCCTAGGGCT CTAGGGCTCCTGGACGGAGGGGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 13, 3: 26, 4: 132} {0: 2, 1: 3, 2: 1, 3: 12, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!