ID: 900094917_900094934

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 900094917 900094934
Species Human (GRCh38) Human (GRCh38)
Location 1:936394-936416 1:936434-936456
Sequence CCCGCCTCCTAGGGCTCCTGGAC GGTCCCGCCTTCTAGGGCTCCGG
Strand - +
Off-target summary {0: 5, 1: 0, 2: 1, 3: 37, 4: 353} {0: 1, 1: 0, 2: 0, 3: 12, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!