ID: 900104521_900104522

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 900104521 900104522
Species Human (GRCh38) Human (GRCh38)
Location 1:976650-976672 1:976670-976692
Sequence CCACGGCTGCACTCAGAGATGGC GGCCCCGCACACGCCCGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 115} {0: 1, 1: 1, 2: 2, 3: 45, 4: 287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!