ID: 900115396_900115406

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 900115396 900115406
Species Human (GRCh38) Human (GRCh38)
Location 1:1025851-1025873 1:1025878-1025900
Sequence CCGGGTGAAGGGCCCACCTCTGT CCCAACCCCGGGGCTCCTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 222} {0: 1, 1: 0, 2: 3, 3: 40, 4: 323}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!