ID: 900119926_900119941

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 900119926 900119941
Species Human (GRCh38) Human (GRCh38)
Location 1:1044245-1044267 1:1044277-1044299
Sequence CCCAGGCAGCCCGGTGAGCTCTG CTCTCGGCGGGCGGCGGGGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 187} {0: 1, 1: 0, 2: 5, 3: 39, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!