ID: 900168515_900168519

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 900168515 900168519
Species Human (GRCh38) Human (GRCh38)
Location 1:1254744-1254766 1:1254758-1254780
Sequence CCAGACCAGCACCCGCGGACGCC GCGGACGCCAGCTCCACCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 108} {0: 1, 1: 0, 2: 1, 3: 13, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!