ID: 900180943_900180962

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 900180943 900180962
Species Human (GRCh38) Human (GRCh38)
Location 1:1310707-1310729 1:1310759-1310781
Sequence CCGTCCCCAGGGGGTGGGGCTGA TCTGGGTCGTGGGCGGCTCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 53, 4: 411} {0: 1, 1: 0, 2: 0, 3: 10, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!