ID: 900191888_900191901

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 900191888 900191901
Species Human (GRCh38) Human (GRCh38)
Location 1:1355568-1355590 1:1355612-1355634
Sequence CCGCGCGGGGCCACCCCCGGGGC CGCGCTGGCGGTCGTGCAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 24, 4: 262} {0: 1, 1: 0, 2: 0, 3: 9, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!