ID: 900207179_900207183

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 900207179 900207183
Species Human (GRCh38) Human (GRCh38)
Location 1:1436539-1436561 1:1436552-1436574
Sequence CCTCAGGCTGCTCCTCTGAAAGC CTCTGAAAGCCATGCCTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 48, 4: 663} {0: 1, 1: 0, 2: 1, 3: 26, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!