ID: 900213525_900213533

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 900213525 900213533
Species Human (GRCh38) Human (GRCh38)
Location 1:1468754-1468776 1:1468779-1468801
Sequence CCACAGAGGGGTGGGCTTCACAG GGTGGCTGCCACGGCGGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 0, 3: 32, 4: 160} {0: 1, 1: 0, 2: 4, 3: 48, 4: 444}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!