ID: 900223174_900223177

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 900223174 900223177
Species Human (GRCh38) Human (GRCh38)
Location 1:1520259-1520281 1:1520274-1520296
Sequence CCGCCTGAAGGCGGCCGAGCACC CGAGCACCGTCAGACCGTCTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 5, 4: 95} {0: 2, 1: 0, 2: 0, 3: 0, 4: 16}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!