ID: 900223953_900223962

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 900223953 900223962
Species Human (GRCh38) Human (GRCh38)
Location 1:1524078-1524100 1:1524116-1524138
Sequence CCCTCGTGTAGGCTCAGGGTGCT GCCTCCCATCTTCCAGGCGGGGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 0, 3: 5, 4: 70} {0: 3, 1: 0, 2: 0, 3: 16, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!