ID: 900237392_900237398

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 900237392 900237398
Species Human (GRCh38) Human (GRCh38)
Location 1:1599293-1599315 1:1599317-1599339
Sequence CCTCAGGCAGGTGGCGCAAAGAT GGCGGGCGGCCTCGCGCTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 108} {0: 1, 1: 0, 2: 2, 3: 10, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!