ID: 900253128_900253136

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 900253128 900253136
Species Human (GRCh38) Human (GRCh38)
Location 1:1682105-1682127 1:1682135-1682157
Sequence CCGCCTTGGCCTCCCATAGAACT CAGGCATGAGTGACCGTGCCCGG
Strand - +
Off-target summary {0: 2, 1: 47, 2: 3042, 3: 67285, 4: 160116} {0: 5, 1: 276, 2: 8927, 3: 47450, 4: 121254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!