|
Left Crispr |
Right Crispr |
Crispr ID |
900253128 |
900253136 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:1682105-1682127
|
1:1682135-1682157
|
Sequence |
CCGCCTTGGCCTCCCATAGAACT |
CAGGCATGAGTGACCGTGCCCGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 47, 2: 3042, 3: 67285, 4: 160116} |
{0: 5, 1: 276, 2: 8927, 3: 47450, 4: 121254} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|