ID: 900255030_900255035

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 900255030 900255035
Species Human (GRCh38) Human (GRCh38)
Location 1:1693424-1693446 1:1693441-1693463
Sequence CCCGGAGCTGCGGGGGGCGGGGC CGGGGCCGCCGCGCGGGGTGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 7, 3: 89, 4: 747} {0: 2, 1: 1, 2: 5, 3: 56, 4: 483}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!