ID: 900261033_900261041

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 900261033 900261041
Species Human (GRCh38) Human (GRCh38)
Location 1:1729633-1729655 1:1729674-1729696
Sequence CCTCCCAAAGTGCTGGGATTAGA CGGTCTTCTATTAGTTTTTGAGG
Strand - +
Off-target summary {0: 2826, 1: 319470, 2: 266870, 3: 145698, 4: 131355} {0: 1, 1: 1, 2: 0, 3: 4, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!