ID: 900262455_900262457

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 900262455 900262457
Species Human (GRCh38) Human (GRCh38)
Location 1:1738848-1738870 1:1738888-1738910
Sequence CCCGCTCTAGTAACGAGAGGGAC AGAGACACTCAACCAAAACCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 1, 4: 29} {0: 2, 1: 0, 2: 0, 3: 24, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!