ID: 900264802_900264810

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 900264802 900264810
Species Human (GRCh38) Human (GRCh38)
Location 1:1751835-1751857 1:1751875-1751897
Sequence CCGTGGAAGACGCGGGCGCCGGG GCTCCACAGCTGCCGGTGCTGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 6, 4: 96} {0: 1, 1: 1, 2: 2, 3: 16, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!