ID: 900280368_900280375

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 900280368 900280375
Species Human (GRCh38) Human (GRCh38)
Location 1:1863423-1863445 1:1863438-1863460
Sequence CCTTGCCCACTGTGGCTGCTGCC CTGCTGCCACTGGAGGGGTTTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 6, 3: 71, 4: 554} {0: 1, 1: 0, 2: 2, 3: 22, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!