ID: 900308511_900308517

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 900308511 900308517
Species Human (GRCh38) Human (GRCh38)
Location 1:2022454-2022476 1:2022467-2022489
Sequence CCTCCAGGTGAGCTTCGTGGCGG TTCGTGGCGGGGGCTGCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 50} {0: 1, 1: 0, 2: 2, 3: 16, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!