ID: 900308563_900308583

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 900308563 900308583
Species Human (GRCh38) Human (GRCh38)
Location 1:2022726-2022748 1:2022766-2022788
Sequence CCTGCTCCTCCTTAGCCCTGTGC TCCCGTGGGCGCGGGGTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 99, 4: 1009} {0: 1, 1: 0, 2: 0, 3: 17, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!