ID: 900309704_900309716

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 900309704 900309716
Species Human (GRCh38) Human (GRCh38)
Location 1:2027816-2027838 1:2027855-2027877
Sequence CCAGAAAGCCTGGAGCAGTCTGG CTGCCTGGGGAGCCGGGCCATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 182} {0: 1, 1: 0, 2: 2, 3: 52, 4: 360}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!