ID: 900310171_900310183

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 900310171 900310183
Species Human (GRCh38) Human (GRCh38)
Location 1:2029731-2029753 1:2029765-2029787
Sequence CCAAGGTCAAGGTCTCCAGGCCG GAGGGCCTGGGGCCGAGCCAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 125} {0: 1, 1: 0, 2: 1, 3: 46, 4: 524}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!