ID: 900345824_900345832

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 900345824 900345832
Species Human (GRCh38) Human (GRCh38)
Location 1:2209838-2209860 1:2209889-2209911
Sequence CCTCCTGCCTTCTGTCCAGACAG CGCACATCCCTGCTGCAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 339} {0: 1, 1: 0, 2: 1, 3: 19, 4: 249}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!