ID: 900360000_900360020

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 900360000 900360020
Species Human (GRCh38) Human (GRCh38)
Location 1:2283877-2283899 1:2283927-2283949
Sequence CCGAGGCAGCAAAGCTGACCCGC CCTTCCTGCAGGAGGCGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 131} {0: 1, 1: 0, 2: 4, 3: 41, 4: 446}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!