ID: 900363661_900363677

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 900363661 900363677
Species Human (GRCh38) Human (GRCh38)
Location 1:2301734-2301756 1:2301785-2301807
Sequence CCACCAAGGCTTCCTGGCTGAGG TTGCTGCCTCCTCTTGAGGTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 37, 4: 395} {0: 1, 1: 0, 2: 2, 3: 43, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!