ID: 900379515_900379525

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 900379515 900379525
Species Human (GRCh38) Human (GRCh38)
Location 1:2376991-2377013 1:2377026-2377048
Sequence CCTCCCACCCGGGCCTCAGGGAG GTCCAGGCCGATGCCCAGCGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 54, 4: 661} {0: 1, 1: 0, 2: 1, 3: 10, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!