ID: 900384992_900385000

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 900384992 900385000
Species Human (GRCh38) Human (GRCh38)
Location 1:2406456-2406478 1:2406507-2406529
Sequence CCAGGACGGCAGCAGGCTCCCAC TGCACTCCCAGCAGAACAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 181} {0: 1, 1: 0, 2: 0, 3: 29, 4: 677}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!