ID: 900391107_900391113

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 900391107 900391113
Species Human (GRCh38) Human (GRCh38)
Location 1:2434346-2434368 1:2434361-2434383
Sequence CCCCAGCTCCTTGTGCCGTGGGG CCGTGGGGCCCCTTCTCTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 175} {0: 1, 1: 0, 2: 5, 3: 22, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!