ID: 900414870_900414880

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 900414870 900414880
Species Human (GRCh38) Human (GRCh38)
Location 1:2530314-2530336 1:2530346-2530368
Sequence CCTGGAGTCCGGGCGCCGCGGCC CTCCGCGGCCAATGGCCGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 343} {0: 1, 1: 0, 2: 0, 3: 3, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!