ID: 900434958_900434964

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 900434958 900434964
Species Human (GRCh38) Human (GRCh38)
Location 1:2625576-2625598 1:2625622-2625644
Sequence CCTGCTATCTTCTGCAGTTAACT GGCCCGTTACTGGGCTTTGGTGG
Strand - +
Off-target summary {0: 1, 1: 10, 2: 206, 3: 206, 4: 239} {0: 5, 1: 150, 2: 161, 3: 88, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!