ID: 900457157_900457168

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 900457157 900457168
Species Human (GRCh38) Human (GRCh38)
Location 1:2782759-2782781 1:2782791-2782813
Sequence CCCTCCTCCTTTTACAGAGGAGG CCTGGGGAGGTGAAGTGATTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 17, 3: 173, 4: 717} {0: 1, 1: 0, 2: 1, 3: 32, 4: 273}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!