ID: 900537752_900537766

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 900537752 900537766
Species Human (GRCh38) Human (GRCh38)
Location 1:3187238-3187260 1:3187291-3187313
Sequence CCTGGTGGGCCCTGGCCCTTCTG TTTTTGGCAGGGCCCCTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 362} {0: 1, 1: 0, 2: 2, 3: 14, 4: 268}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!