ID: 900588524_900588526

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 900588524 900588526
Species Human (GRCh38) Human (GRCh38)
Location 1:3446179-3446201 1:3446199-3446221
Sequence CCTATATCCATGAGGAATATTAG TAGTCTATAATTTTGTTTTCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!