ID: 900599520_900599527

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 900599520 900599527
Species Human (GRCh38) Human (GRCh38)
Location 1:3497098-3497120 1:3497117-3497139
Sequence CCAAAGCTGCCGGGTGGGCAGGC AGGCTGGGTGGAGACAGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 177} {0: 1, 1: 0, 2: 11, 3: 93, 4: 751}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!