ID: 900605501_900605511

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 900605501 900605511
Species Human (GRCh38) Human (GRCh38)
Location 1:3521846-3521868 1:3521882-3521904
Sequence CCAGAGAGTGCCAGGAAGGGGGT AAGCAGGGTGGCCTAGAAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 272} {0: 1, 1: 0, 2: 0, 3: 22, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!