ID: 900625464_900625470

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 900625464 900625470
Species Human (GRCh38) Human (GRCh38)
Location 1:3606528-3606550 1:3606573-3606595
Sequence CCTTGCCAGGTTTGCATGAGGGT GGCTCCCGACAGCCCTCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 108} {0: 1, 1: 0, 2: 2, 3: 16, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!