ID: 900636366_900636374

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 900636366 900636374
Species Human (GRCh38) Human (GRCh38)
Location 1:3667937-3667959 1:3667980-3668002
Sequence CCCCCCAGGGCTCATGGCCACTG TTCAGACCAGGGAACAGACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 299} {0: 1, 1: 0, 2: 1, 3: 19, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!