ID: 900655256_900655267

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 900655256 900655267
Species Human (GRCh38) Human (GRCh38)
Location 1:3753772-3753794 1:3753786-3753808
Sequence CCTGTGACCAGCAGCATGTGTGG CATGTGTGGGTGGGGTCGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 187} {0: 1, 1: 0, 2: 4, 3: 72, 4: 739}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!