ID: 900663027_900663040

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 900663027 900663040
Species Human (GRCh38) Human (GRCh38)
Location 1:3795608-3795630 1:3795661-3795683
Sequence CCAGTTAACAGAATGCGGGGGAG CAGGAGAAGGGGGAGTTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 53} {0: 2, 1: 0, 2: 4, 3: 113, 4: 1043}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!