ID: 900663233_900663241

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 900663233 900663241
Species Human (GRCh38) Human (GRCh38)
Location 1:3796461-3796483 1:3796491-3796513
Sequence CCGCTGCCGCCGCCATGGCGCCT TGGCAGGCACCCACCCACCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 275} {0: 1, 1: 1, 2: 3, 3: 71, 4: 279}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!