ID: 900667032_900667042

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 900667032 900667042
Species Human (GRCh38) Human (GRCh38)
Location 1:3822512-3822534 1:3822565-3822587
Sequence CCTGAGCAGGGCCCCAGGGCTCA GCCAGCCCATCGTGTTGGACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 16, 3: 48, 4: 436} {0: 1, 1: 0, 2: 0, 3: 8, 4: 60}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!