ID: 900686090_900686098

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 900686090 900686098
Species Human (GRCh38) Human (GRCh38)
Location 1:3948543-3948565 1:3948596-3948618
Sequence CCATTTGCCAGCTGTGCAAACTC CTGTAAAGGGAAGGTAGATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 48, 4: 379} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!