ID: 900791784_900791795

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 900791784 900791795
Species Human (GRCh38) Human (GRCh38)
Location 1:4685641-4685663 1:4685679-4685701
Sequence CCCAAGACCAAGACCCTGCCCCA GCTCCACAAAGAAGGCTCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 19, 3: 46, 4: 499} {0: 1, 1: 0, 2: 2, 3: 17, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!