ID: 900961435_900961442

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 900961435 900961442
Species Human (GRCh38) Human (GRCh38)
Location 1:5923610-5923632 1:5923629-5923651
Sequence CCTCCAGCCACCTGGTAATCCTC CCTCATTCTTCATGGGACACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 188} {0: 1, 1: 0, 2: 3, 3: 16, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!