ID: 900974577_900974585

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 900974577 900974585
Species Human (GRCh38) Human (GRCh38)
Location 1:6009048-6009070 1:6009077-6009099
Sequence CCCTTCTCCCCCAGGAGCTGCAG CTCTGAGCCTCTGTTTGAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 63, 4: 554} {0: 1, 1: 0, 2: 2, 3: 37, 4: 437}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!