ID: 900981766_900981777

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 900981766 900981777
Species Human (GRCh38) Human (GRCh38)
Location 1:6049867-6049889 1:6049896-6049918
Sequence CCCCCATGAAAGAGGCAGCTGTG CTGGAGGTGGCCCCCCTCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 247} {0: 1, 1: 0, 2: 2, 3: 13, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!